human c jun Search Results


92
Novus Biologicals elisa
Elisa, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/elisa/product/Novus Biologicals
Average 92 stars, based on 1 article reviews
elisa - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

90
Bio-Techne corporation c jun human
C Jun Human, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c jun human/product/Bio-Techne corporation
Average 90 stars, based on 1 article reviews
c jun human - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Boster Bio pavecs
Pavecs, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pavecs/product/Boster Bio
Average 93 stars, based on 1 article reviews
pavecs - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Oncogene Science Inc 1 mg of a purified rabbit polyclonal antiserum raised against a peptide spanning the 15 c-terminal residues of the human c-jun protein
1 Mg Of A Purified Rabbit Polyclonal Antiserum Raised Against A Peptide Spanning The 15 C Terminal Residues Of The Human C Jun Protein, supplied by Oncogene Science Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 mg of a purified rabbit polyclonal antiserum raised against a peptide spanning the 15 c-terminal residues of the human c-jun protein/product/Oncogene Science Inc
Average 90 stars, based on 1 article reviews
1 mg of a purified rabbit polyclonal antiserum raised against a peptide spanning the 15 c-terminal residues of the human c-jun protein - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Biomics Biotechnologies sirna targeting human c-jun mrna
Sirna Targeting Human C Jun Mrna, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna targeting human c-jun mrna/product/Biomics Biotechnologies
Average 90 stars, based on 1 article reviews
sirna targeting human c-jun mrna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Abnova purified human c-jun protein #h00003725-p01
Purified Human C Jun Protein #H00003725 P01, supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/purified human c-jun protein #h00003725-p01/product/Abnova
Average 90 stars, based on 1 article reviews
purified human c-jun protein #h00003725-p01 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GloboZymes recombinant full-length human c-jun
Recombinant Full Length Human C Jun, supplied by GloboZymes, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant full-length human c-jun/product/GloboZymes
Average 90 stars, based on 1 article reviews
recombinant full-length human c-jun - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Shanghai Genechem Ltd shrna sequence (ccggcggaccttatggctacagtaacg ctgtagccataaggtccgtttttg) targeting human c-jun gene
Shrna Sequence (Ccggcggaccttatggctacagtaacg Ctgtagccataaggtccgtttttg) Targeting Human C Jun Gene, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna sequence (ccggcggaccttatggctacagtaacg ctgtagccataaggtccgtttttg) targeting human c-jun gene/product/Shanghai Genechem Ltd
Average 90 stars, based on 1 article reviews
shrna sequence (ccggcggaccttatggctacagtaacg ctgtagccataaggtccgtttttg) targeting human c-jun gene - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Oncogene Science Inc human c-jun oligonucleotide probe
Human C Jun Oligonucleotide Probe, supplied by Oncogene Science Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human c-jun oligonucleotide probe/product/Oncogene Science Inc
Average 90 stars, based on 1 article reviews
human c-jun oligonucleotide probe - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Chiron Corporation human c-jun cdna
Human C Jun Cdna, supplied by Chiron Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human c-jun cdna/product/Chiron Corporation
Average 90 stars, based on 1 article reviews
human c-jun cdna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Serono pcdna3 containing either wild-type human c-jun
Pcdna3 Containing Either Wild Type Human C Jun, supplied by Serono, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna3 containing either wild-type human c-jun/product/Serono
Average 90 stars, based on 1 article reviews
pcdna3 containing either wild-type human c-jun - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Upstate Biotechnology Inc synthetic peptide corresponding portion human c jun protein
Synthetic Peptide Corresponding Portion Human C Jun Protein, supplied by Upstate Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic peptide corresponding portion human c jun protein/product/Upstate Biotechnology Inc
Average 90 stars, based on 1 article reviews
synthetic peptide corresponding portion human c jun protein - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results